Sunday, April 29, 2007

Study Break

I just realised blogging helps release stress a little. I'm supposed to be studying, but I've got so much crammed in. Its like the more I study, the more the facts get jumbled up.

Oh well, to all the people out there who are having their exams like Gera, Huilin, Lishi, Chris, and tons more, Keep Going!

I'll be mugging with you, even though mine's a test. But its still a LOT to study. So, I'll be suffering with you!

Anyway, like I said, I'll show you my high cut brown converse sneakers. TaDah!! Haha, they're so boyish, but I love them! I tried on the girlish colours like red, maroon, purple, but they just didn't suit my skin colour or should I say, me as a whole.



I realised I suited colours like brown, green, blue, black, white. Haha, dark ones, such a bummer.

Can you imagine me in a pink shirt?

I don't think so.....

More pics of my sneakers! I paid AUD40. Not very cheap but not very expensive either. =D


Its double tongue somemore!


Oh. Remember the magical straw? Joanne and me finished the banana pack, so its chocolate mint time! Check out the beads man, funky bits of brown and baby blue.


Tasted a tad weird at first, but once the beads started to melt, it tasted goooood.

Next off, Queen Victoria Market!

This is the entrance to the place where I go marketing every saturday. A 20 minutes walk from my house. I've grown to like this place. I'll never be caught in a market in Singapore (I've never stepped in one in the first place), but not here! Its so clean, and it doesn't smell.

The sights and smells are a sight to behold.
A pity pictures cannot capture the beauty of it....


When you step in, this is the meat section. There're rows and rows of meat stalls, all in an air-conditioned room. Beef, pork, fish, chicken, lamb, kangaroo, and the works. The butchers would sometimes wear placards and start shouting their discounted prices. Sometimes, they'd sing as well, but not as much as in the veg and fruits section.



After coming out of the meat place, its rows of tents that sell veggies and fruits. Here, the fruit sellers start singing, "Apples for sale, Nice and Fresh ones, Come and buy, They smell so good, blah blah" Haha, the tunes they come up with are quite funny.

And the stuff here are usually very fresh.



Didn't take a lot of pictures cause I didn't want to embarrass my friend anymore by acting like a tourist. =D

When I'm alone, I'll take pictures of the veg section for you people to see!

Okok, I took too long a break from the studying already. Haha, close to 2 hours!!

Its back to studying!
And thats like saying
bye to friends,
bye to life,
bye to freedom,
but soon soon!,
it'll be over.

For the sake of knowledge,
persevere!

Saturday, April 28, 2007

A Glimpse of my Apartment

This week is another hectic week, but compared to the last one, its a breeze! Another assignment done, and another test coming up on tuesday. I'm just trying to squeeze in this entry before I finish downloading something, then its off to studying again! Bleah.

Anyway, last sunday was my roommate's 21st birthday. We went to eat at this place called Cafe Corretto at Lygon Street. The pizzas there were AWESOME. Luckily we went there early, I heard you've always got to wait very long for a table. Anyway, it was a breeze getting one that day. Ordered some mushroom and corretto special pizza. It was sooooo gooooood. Doesn't taste like your normal, commercialised Pizza Hut pizza, but authentic italian ones. Thinking of it makes me hungry!! Yum yum! Too bad I forgot to take pictures of it. Anyway, after that we went to the supermart, did a bit of grocery shopping, and bought a chocolate roll cake as a substitute for a proper birthday one.

But first, an introduction to my roommates. From left: Jialin, Janice and Joanne. All J's!! Haha, I kinda just realised.


Joanne stays in the same apartment with me. Jialin stays in a 1 bedroom apartment opposite us.

Jialin and her birthday cake. Haha, so much for a 21st birthday celebration.

This is the pathetic living room. Everything you see in this pic, is the whole room actually. Joanne's taking out the cake.

I was standing at the shoe area taking that living room pic. See our array of shoes, and this is the minimum. Haha, only the top rack, and the black flat boots at the side is mine. The rest are a mixture of Joanne's and Jialin's. But in my room, I still have my running sneakers, my black heels, my black heeled boots, my latest addition (A brown high cut converse sneaker!!, which i'll show you in another post), and..I think thats about it acutally.

Beside the shoe area, is my room. I'm taking this picture of Jialin standing from my room door. She's standing beside Joanne's room. From here, you can see a glimpse of the living room! My apartment is shit small.

My humble abode. The place where I relax, go insane, and stress out.

Across the shoe rack, on the other side, is the toilet! I don't know why Jialin keeps popping up. Haha, I didn't realise it myself. Maybe she's my model.

Anyway, this is the 3 of us again. We're so different in personalities, but we're still getting along just fine. Not too many bumps...yet.

The Janice, Joanne, Jialin Story.

Friday, April 20, 2007

Toughest Week Yet

This whole week has been so packed and hectic. Everyday I would come back home from school at about 11am, sit infront of the computer, do report/study, come out for dinner at 630pm, go into the room by 8pm, and do work all the way til 4am. Wake up 7am plus or so and repeat the whole process. No break at all man. I was on high stress mode the whole time, and the result of it is a pimple outbreak, feeling depressed and insomnia.

I've never felt so stressed before. Its been the toughest week of my life with stupid tests and many assignments to pass up. It doesn't help that the report that I'm supposed to hand in today by 5pm is 50% of my whole grade. Plus, the bacteria sequence that I did just didn't want to cooperate with me. I send it through GenBank, Blastn, Blastx, CDC, and all of them came back with different strains. =( Not that most of you would know what I'm talking about, but its about 5 hours of looking at a series of As, Ts, Cs and Gs in the thousands. Something like this:


ATGCTGATTGAGCCGTTAGTTCGAATCGATTTTAGCTAGTGATCGAGT,
and you've got to check every single of these letters to make sure it corresponds properly. Any single error is like DOOM for me, cause any single change will make it a new strain of bacteria! Bleah.
I don't think I did it well. Oh well, its over.

Moving onto lighter stuff. My roomies and I were watching The Biggest Loser, and one of the finalist really lost so MUCH weight that I'm sure if he lost more, he'd go underweight. He's changed from this really fat guy with big moobs, to a really suave, tall, lanky and handsome guy. Can you imagine a contestant from Biggest Loser going in severely overweight and coming out underweight? I think its damn hilarious. Haha, but you should see his transformation. Sweet.

Ok, I think this is the first post without photos. Im just feeling so dead typing this now. Trying to kill time, waiting for my friend's call so that I can bunk over. Need to get out of my room after the whole week of cooping up. Driving me crazy.

I shall end it here then, cause my brain is perpetually not working, and I've got nothing else to write. Oh, and I miss my family. I think I'm starting to feel homesick, or maybe its cause of the stress. But talking to them through the webcam on Thursday night was so good. I talked to my maid (she's like my second mum), and I was on the verge of tears. I so wanted to reach over and give her a hug, and tell her I love her. She's been with our family for like 13 years, and it only just dawned on me last night that she's really so precious to me.

Mummy's in Taiwan with my grandmother. Hope she has a good trip!

I miss you guys in Singapore. =(

Monday, April 16, 2007

The Menace

All thanks to my dear friend who did the editing of the photos for the sake of making me happy. =)

Haha, its so nice, I had to put it up!

He calls it The Menace pictures.


Janice the Menace, Hear me Roar!










Colour Me Beautiful

Sunday, April 8, 2007

Saturday - BBQ, Skateboard Exhibition, Greco!!

PHOTOS GALORE!!

Today was a packed day as you can see from the title. We had BBQ, then I went to a skateboard exhibition then to Greco, which is a place that sells GREAT cakes!!

Haha, a crazy day.

Yummy chicken!


Jason the chef. Grills good lamb chops, steaks, ribs, sausages. Mmmm!!




Jason and Ling.


At the dining area, facing the BBQ pit...
Ian and me.



Outside on the road, making a fool of ourselves, and having fun with Jason's totally funky bicycle!


Love the effect..


3 weirdos. Me, Ling, and Tavis.



Vrrooom Vrrrooooommm...



Ahh!..squashed!



And there was Happy Cookie time!!
Look at all the happy faces...


Yum yum! Specially baked by Ian. Double Chocolate chip with extras.


The ARMY PARADE!!



Everybody has a hidden MONSTER that comes out once in a while...
Haha, Angie's face is classic.


Posing.


Silly times...



The Skateboard exhibition at Federation Square! My camera ran out of batt, so only 2 pictures from the exhibition. Quite bummed out actually, cause the designs were out of this world and so nice!!

Then to GRECO. We had Mars Bars Cheesecake, which is da BOMB, tirimisu, and something else. Look at the cakes man, all so nice.

Ahh!..I've got a weakness for them. Miss my old-time cake company, Gary! More money fly away.. =(


Pharmacy! 6 April 07

I'm done with one of my subjects!
Took the final exam on 4th April. So fast right!! I'm barely 2 months here, and I'm done with one module. Wheepees! Anyway, drawings I did while studying again. I think its nice, so I've got to put it up!!


Exams are over, so its time to partyyy!!!

Pharmacy was a rave I went to. Its my first rave and boy, did I have a GREAT time. Great can't even express it. More like a BLAST!!!

The music was good. First time I learn how to appreciate Trance and DJs. Hated Trance last time, but I'm a changed person! Haha, the music's way goooood, once you have the right company.

Awwww, I just love my friends!

Oh, and rave is like a culture here also. They've got a set of dance that came out of raves, and it originated from Melbourne. Its called the Melbourne Shuffle! Plus, the rave culture here is so much, that they've got a type of attire that is associated with it. Baggy pants with neon, fluorescent designs, so that in the dark, it'll light up! Or it can be really furry socks that move when you do the shuffle. You can go check it up. Way cool just looking at the ravers go at it.

The DJ's playing...


and we're posing!!







All in all, I'd like to go again!