A year has passed.

Stumbled onto my blog again.

Looking back at the old posts, the memories, the stories...brings about a tinge of sadness.

Oh, how much I've grown, how much I've matured over the past year.

I'm changing. For better or for worst, I don't know. Seems like for the worst at the moment. All I know is I'm trying to grapple with emotions I've never felt before. Strong ones that make or break me.

2008 was a year of change, of maturing.


Reading back, I can't even keep up with my "hyperness".

I long for that side of me again.

Oh, how I've grown.

That Drummer in the Sky

B4 you go

Oh B4 you go

I need to say this so you'll know

I'll miss you so

I'll miss you so

Oh I have never known a one like you

With eyes so blue

A heart so true

A heart so true

I don't know where I'll go

I'll say into the unknown

I hope someday I'll find

A one like you to be mine

Oh show me where's the sunshine

http://www.myspace.com/thesunsrock

http://www.waynethunder.com/

We were suppose to meet up when I got back in December, but you didn't wait for me. =( How am I supposed to catch up with you now, and do all the crazy things that we planned to do? Sigh, sometimes I'd look at your nick on msn, and patiently hope that you'd come online. Your messages are still in my phone. Our last convo on msn last week was just full of nonsense, about man's balls to be exact. Haha, everytime I think about it, it makes me smile though. Thank you for always making me feel loved and happy when I was with you. For making me feel special.

I'm sad that you're gone, but looking at how many and how much people love you, I'm comforted as well. A pity we never got the chance to take a picture together. The only one I have of you shows you walking away from me in Half Moon Bay. So apt.

Rest in peace my dear friend,

You'll be missed so dearly.

I'm sorry I never got to say,

How much I cherished and loved you.

But when I hear the thunders,

I'll know you're having a blast drumming

To the greatest gigs in the sky.

And in my heart I'll say,

There goes my friend,

My dear Wayne Thunder.

1977-2007.

At first I was bend on not going back in June, but now I'm not too sure anymore. Rock for Good is on 23rd June, and attending it would be least I can do for you. I know you put in a lot of effort into this and I have a feeling that this year's concert would far exceed your expectations. Sales would go through the roof! We'll rock for you!

Now, its whether I should fly back or not.

I'll miss you guys..

Thank you for being that bridge between Melbourne and Singapore. I never could have done it without you. I've gained really good friends and its all cause of you.

The times when you were here, and we just chilled out were awesome. The beach, the ice-cream, the dinners, the crazy stuff like heading into all the xxx shops just to have a good laugh, and best of all, the company.

I'll miss you. Looks like our plans on me heading back to Singapore in December for your gig, and I, acting as your personal groupie is gone.

The Suns will not be the same.
And the local music scene has just lost a great musician.

You'll be missed.

Passed - 21 May 2007







---------------------------------------------------------------

I thought when I come back in December, I'll be able to play with you, but looks like you had other plans. You must have suffered for quite a long time, but nevertheless, you'll always be my baby.

At first I was afraid of getting close to you, but you taught me that there was more to you than just sharp teeth masked by a cute face. You had a unique personality that no other clouded leopard would have. You opened up your heart, and we opened ours. Thank you for letting us in.

You gave us a sense of accomplishment at the end of it all, when it was time to test the months of training by a blood draw on the tail. Moreso, you showed us and the world that conditioning you to do that was possible. AP's presentation in Thailand was a success, and it aroused much interest in it. You were the main star of it all.

You've taught me so much just by being you.

I know I'll miss you very much.

Passed - 15 May 07.

Toughest Week Yet

This whole week has been so packed and hectic. Everyday I would come back home from school at about 11am, sit infront of the computer, do report/study, come out for dinner at 630pm, go into the room by 8pm, and do work all the way til 4am. Wake up 7am plus or so and repeat the whole process. No break at all man. I was on high stress mode the whole time, and the result of it is a pimple outbreak, feeling depressed and insomnia.

I've never felt so stressed before. Its been the toughest week of my life with stupid tests and many assignments to pass up. It doesn't help that the report that I'm supposed to hand in today by 5pm is 50% of my whole grade. Plus, the bacteria sequence that I did just didn't want to cooperate with me. I send it through GenBank, Blastn, Blastx, CDC, and all of them came back with different strains. =( Not that most of you would know what I'm talking about, but its about 5 hours of looking at a series of As, Ts, Cs and Gs in the thousands. Something like this:

ATGCTGATTGAGCCGTTAGTTCGAATCGATTTTAGCTAGTGATCGAGT,
and you've got to check every single of these letters to make sure it corresponds properly. Any single error is like DOOM for me, cause any single change will make it a new strain of bacteria! Bleah.
I don't think I did it well. Oh well, its over.

Moving onto lighter stuff. My roomies and I were watching The Biggest Loser, and one of the finalist really lost so MUCH weight that I'm sure if he lost more, he'd go underweight. He's changed from this really fat guy with big moobs, to a really suave, tall, lanky and handsome guy. Can you imagine a contestant from Biggest Loser going in severely overweight and coming out underweight? I think its damn hilarious. Haha, but you should see his transformation. Sweet.

Ok, I think this is the first post without photos. Im just feeling so dead typing this now. Trying to kill time, waiting for my friend's call so that I can bunk over. Need to get out of my room after the whole week of cooping up. Driving me crazy.

I shall end it here then, cause my brain is perpetually not working, and I've got nothing else to write. Oh, and I miss my family. I think I'm starting to feel homesick, or maybe its cause of the stress. But talking to them through the webcam on Thursday night was so good. I talked to my maid (she's like my second mum), and I was on the verge of tears. I so wanted to reach over and give her a hug, and tell her I love her. She's been with our family for like 13 years, and it only just dawned on me last night that she's really so precious to me.

Mummy's in Taiwan with my grandmother. Hope she has a good trip!

I miss you guys in Singapore. =(

Missing everybody...

Somewhere out there

Somewhere out there

Beneath the pale moon light

Someone's thinking of me

And loving me tonight

Somewhere out there

Someone's saying a prayer

That we'll find one another

In that big somewhere out there

And even though

I know how very far apart we are

It helps to think

We might be wishing on the same bright star

And when the night wind

Starts to sing a lonesome lullaby

It helps to think

We might be sleeping underneath the same big sky

Somewhere out there

If love can see us through

Then when we're together

Somewhere out there

Out where dreams come true...

- Disney, An American Tale

I miss home..