This whole week has been so packed and hectic. Everyday I would come back home from school at about 11am, sit infront of the computer, do report/study, come out for dinner at 630pm, go into the room by 8pm, and do work all the way til 4am. Wake up 7am plus or so and repeat the whole process. No break at all man. I was on high stress mode the whole time, and the result of it is a pimple outbreak, feeling depressed and insomnia.
I've never felt so stressed before. Its been the toughest week of my life with stupid tests and many assignments to pass up. It doesn't help that the report that I'm supposed to hand in today by 5pm is 50% of my whole grade. Plus, the bacteria sequence that I did just didn't want to cooperate with me. I send it through GenBank, Blastn, Blastx, CDC, and all of them came back with different strains. =( Not that most of you would know what I'm talking about, but its about 5 hours of looking at a series of As, Ts, Cs and Gs in the thousands. Something like this:
ATGCTGATTGAGCCGTTAGTTCGAATCGATTTTAGCTAGTGATCGAGT,
and you've got to check every single of these letters to make sure it corresponds properly. Any single error is like DOOM for me, cause any single change will make it a new strain of bacteria! Bleah.
I don't think I did it well. Oh well, its over.
Moving onto lighter stuff. My roomies and I were watching The Biggest Loser, and one of the finalist really lost so MUCH weight that I'm sure if he lost more, he'd go underweight. He's changed from this really fat guy with big moobs, to a really suave, tall, lanky and handsome guy. Can you imagine a contestant from Biggest Loser going in severely overweight and coming out underweight? I think its damn hilarious. Haha, but you should see his transformation. Sweet.
Ok, I think this is the first post without photos. Im just feeling so dead typing this now. Trying to kill time, waiting for my friend's call so that I can bunk over. Need to get out of my room after the whole week of cooping up. Driving me crazy.
I shall end it here then, cause my brain is perpetually not working, and I've got nothing else to write. Oh, and I miss my family. I think I'm starting to feel homesick, or maybe its cause of the stress. But talking to them through the webcam on Thursday night was so good. I talked to my maid (she's like my second mum), and I was on the verge of tears. I so wanted to reach over and give her a hug, and tell her I love her. She's been with our family for like 13 years, and it only just dawned on me last night that she's really so precious to me.
Mummy's in Taiwan with my grandmother. Hope she has a good trip!
I miss you guys in Singapore. =(
Friday, April 20, 2007
Subscribe to:
Post Comments (Atom)
8 comments:
janice why u don wana align all the sequences to check against each other, wouldnt it be faster? use clustal program lar.. =)
i wouldn't say i miss you but prolly cus i have not found any close friends in NUS (though i have some friends I pour my heart to in hall)-people whom you can relax yourself to and dont put on a mask, sometimes, i wished you were in singapore. =)
those stupid things we can do or say..
" wa, the sugar can last for a lifetime...."
"shit, we added wrongly.."
haha, this is one classic joke la..!!
I used baser and align, its a beter program than cluster actually. They point out all the errors to me, then when i change, give me so many stop codon!!..bang my head against the wall,
I really align already la..but u see the sequencing..some parts got ink blot, I check against reverse primer, give me one base, i check up against one of my back up forward primer tt i did again, also different base..aiyah..not as easy as poly ehhh.. really..this one is manual checking man..
Then like cause I'm doing Streptococcus pyogenes, its got so many serotypes! Type 1.1, is about one base different from 1.2. So, when I send to CDC, GenBank my nucleotide seqeunce..aiyo, CDC give me 1.0, GenBank blastn, give me 1.4, blastx give me something else. Haha, the funny thing is tt when I send in my backup forward primer to CDC, give me 1.0, I send in the repeated one i did, give me 1.5. hahaha..cool right!!..
So so screwed la..
Oh well, I miss talking crap as well, idk, i guess i miss all of you guys' company...But I've got a whole group of friends that im close to here..so tt makes me feel better.. =)
whoa i have no idea what all that gene talk was abt, but i miss seeing your pretty face ard! please takecare of yourself so that your face wun become one big people. haha mine's on the way there tho. TAKECARE OKIE.
haha..HEY ADE!! ive tried leaving comments on your blog since forever but I just can't seem to! When I press enter, it doesn't come up!! Think its my computer problem..
Anyway..I wanted to say I miss you!!
I really do! =)
aiyo shucks, i meant one big pimple. haha and mine's on the way there-one BIG pimple. i wish you well, with the dropping temps and things like that. dun party too hard, hangovers aren't the best thing to have i heard. haha but you look great in those pics(: pretty pretty. haha
Partying helps me destress though, I can dance all my blues away. But not to worry la, I know where my limits and priorities are. =)
Haha, haven't had a hangover before, and don't intend to. The closest I got was a huge tummy upset due to the liquor and beer mix which I won't ever do again. Haha, learnt a HUGE lesson!
The temperature is indeed dropping, but then again, it fluctuates. Adds to the stress my skin faces, but Im trying not to be one BIG PIMPLE!
Haha, at least u can ask the boyfriend to kiss the pimples away.. =D
HEY cheeky ah. pimples are contagious, my classmates used to say. everytime one of us gets one, the others will somehow get one too.
i heard you cant mix your alcohols, they make you drunk wayy faster. and then all that puking. eee.
moisturise! keeps your face smooth as a baby's bottom(: hahaha
♥
Haha, i miss my baby days when my skin was so smooth!! Now its like crap. =(
Been moisturising though, my face, arms, legs, and everywhere. Mighty dry here!
I hope church, you and the bf, and everybody else tt we knw are doing fine! I miss seeing you around as well! Haha, your smile, your dressing, and your skinny figure. =D
Post a Comment